Review



quanta software program version 1 4 0  (Bio-Rad)


Bioz Verified Symbol Bio-Rad is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 96

    Structured Review

    Bio-Rad quanta software program version 1 4 0
    Quanta Software Program Version 1 4 0, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 96/100, based on 3491 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/program+quanta/ChromLab+Software/pm28139399-63-10-15
    Average 96 stars, based on 3491 article reviews
    quanta software program version 1 4 0 - by Bioz Stars, 2026-09
    96/100 stars

    Images

    Related Articles

    SYBR Green Assay:

    Article Title: CCR4-NOT differentially controls host versus virus poly(a)-tail length and regulates HCMV infection.
    Article Snippet: Reagents and Tools table (continued) Reagent/Resource Reference or source Identifier or catalog number GDF15-R ACTTCTGGCGTGAGTATC NOV-F GGAACCGTCAATGTGAGATGCTG NOV-F GGCTTTGAGTGACTTCTTGGTGC TNFRSF11-F GGTCTCCTGCTAACTCAGAAAGG TNFRSF11-R CAGCAAACCTGAAGAATGCCTCC COL15A1-F GGTGACACTGGTTTACCTGGCT COL15A1-R GCCTTTCCAGAGGAATGTCCTC HMGA2-F GAAGCCACTGGAGAAAAACGGC HMGA2-R GGCAGACTCTTGTGAGGATGTC PTX3-F CGAAATAGACAATGGACTCCATCC PTX3-R CTCATCTGCGAGTTCTCCAGCA SERPINB4-F CATGTTGATAGGTCAGGAAATG SERPINB4-R ATTGATACGTCTTTTCTCCG siRNAs: control Negative allstars cat #1027281 Qiagen PARN #1 GAAAAGAAGGAGCGAUAUA Dharmacon PARN #2 CAUGAGAGGGCUUGCCGUA Dharmacon PAN2 #1 GACCUUGUUUGCUGGAUUA Dharmacon PAN2 #2 UCAAGGGUCUUUAUGAGAA Dharmacon PAN3 #1 AAAACAAGGUUGCGAGUAA Dharmacon PAN3 #2 CGACUUACUUCUAUACAGA Dharmacon CNOT1 #1 CUAUAAAGAGGGAACGAGA Dharmacon CNOT1 #2 GGCCAAAUUGUCUCGAAUA Dharmacon CNOT2 #1 CAUGAAUGGAGGAGACGUA Dharmacon CNOT2 #2 GGCAAGUUUAUACGGGCAA Dharmacon CNOT3 #1 GCACUAAGGCACAGUAUCU Dharmacon CNOT3 #2 AGACAUGGGUAGCGUCCAA Dharmacon CNOT6 #1 GAAAGAACGUGGCUAUAAU Dharmacon CNOT6 #2 GAGCACAGGUGGAGUAGAA Dharmacon CNOT6L #1 UGACAGCGCUGCACCUAAA Dharmacon CNOT6L #2 CCAAUUACACCUUUGAUUU Dharmacon CNOT7 #1 CAGCUAGGACUGACAUUUA Dharmacon CNOT7 #2 GGAGAAUUCAGGAGCAAUG Dharmacon CNOT8 #1 UUUCGUAGUUCCAUAGAUU Dharmacon CNOT8 #2 GAGAAUAGCCAGGUUAUCU Dharmacon DCP1A #1 Hs_DCP1A_6 Qiagen DCP1A #2 Hs_DCP1A_7 Qiagen DCP2 #1 GCUUGAAGGCACAACGUAA Dharmacon DCP2 #2 GUAUGGAGGUCUUGAGAAU Dharmacon EDC3 #1 CCUGAUAACAAACGCCUUA Dharmacon EDC3 #2 GGAGAUUGAUACCUAUGAA Dharmacon EDC4 #1 GGAUGGAGAUCGGCAUAAU Dharmacon EDC4 #2 GGACCAUGCCACCCAUUAA Dharmacon DDX6 #1 AGUAUGACCACCACUAUUA Dharmacon DDX6 #2 GAAGGACAAUAUACAAGCA Dharmacon 2023 The Authors EMBO reports 24: e56327 | 2023 15 of 20 D ow nloaded from https://w w w .em bopress.org on January 18, 2024 from IP 2405:201:500a:6157:1950:e193:51b3:796d. .. Reagents and Tools table (continued) Reagent/Resource Reference or source Identifier or catalog number LSM1 #1 CGAGATGGAAGGACACTTATA Qiagen LSM1 #2 CAGCCTCATCGAGGACATTGA Qiagen XRN1 #1 AGAUGAACUUACCGUAGAAUU Burgess & Mohr (2015) XRN1 #2 CAGGTCGTAAATATCAAATAA Qiagen/Burgess & Mohr, (2015) EXOSC9 #1 GCCAAGAAUGCUCCCAUAAU van Dijk et al (2007) EXOSC9 #2 GCAGAAAUUACAGAGCUAA[dT][dT] Sigma TTC37 #1 CAGUGAGACUCGACAGUAA Dharmacon TTC37 #2 GUGUUAUGGUCGUGCAUUA Dharmacon WDR61 #1 AGGAACUCAUGUCGGGAAA Dharmacon WDR61 #2 CAAAGAGAAUGUACGGAUU Dharmacon SKIV2L2 #1 GCACAUACCUCAGCGGGAA Dharmacon SKIV2L2 #2 AGGGAAAAGCAGCGUGUAA Dharmacon XRN2 #1 AAGAGUACAGAUGAUCAUGUU West et al (2004) XRN2 #2 ACACUGUAGUCAGUAUUAAUU Wagschal et al (2012) TNKS1BP1 #1 GAUUCACUGGGUACCUACA[dT][dT] Sigma TNKS1BP1 #2 CACUUUGUGCCUCCUGGGA[dT][dT] Sigma ANXA1 GUGUUCAAUACCAUCCUUA[dT][dT] Sigma LRRC15 CUGACUACCAUUCAGGUCA[dT][dT] Sigma SPARC CUACAUCGGGCCUUGCAAA[dT][dT] Sigma Chemicals, enzymes and other reagents Human IL-4 R&D Systems 6507-IL-010/CF Human IL-12 R&D Systems 10018-IL-010 Human IFN-beta R&D Systems 8499-IF-010/CF actinomycin D Fisher AAJ60148LB0 qScript XLT Quanta 95132-500 SsoAdvanced SYBR green supermix Bio-Rad 1725274 Software SAMtools Li et al (2009) BEDtools Quinlan (2014) BBMAP https://sourceforge.net/projects/bbmap/ TrimGalore https://www.bioinformatics.babraham.ac.uk/projects/trim_galore/ Guppy v4.2.2 MiniMap2 Li (2018) Nanopolish v0.13.3 https://github.com/jts/nanopolish Other NextSeq 550 Illumina CellInsight CX7 LZR Thermofisher DynabeadsTM mRNA Purification Kit Fisher 61006 NEBNext® UltraTM II RNA Library Prep Kit for Illumina NEB E7300S MinION MkIb Oxford Nanopore Technologies Ltd 16 of 20 EMBO reports 24: e56327 | 2023 2023 The Authors D ow nloaded from https://w w w .em bopress.org on January 18, 2024 from IP 2405:201:500a:6157:1950:e193:51b3:796d. .. Cell infection and virus production Normal human dermal fibroblasts (NHDFs) were obtained from Lonza, grown in DMEM supplemented with 5% FBS in the presence of penicillin and streptomycin, and routinely screened for mycoplasma contamination.

    Software:

    Article Title: CCR4-NOT differentially controls host versus virus poly(a)-tail length and regulates HCMV infection.
    Article Snippet: Reagents and Tools table (continued) Reagent/Resource Reference or source Identifier or catalog number GDF15-R ACTTCTGGCGTGAGTATC NOV-F GGAACCGTCAATGTGAGATGCTG NOV-F GGCTTTGAGTGACTTCTTGGTGC TNFRSF11-F GGTCTCCTGCTAACTCAGAAAGG TNFRSF11-R CAGCAAACCTGAAGAATGCCTCC COL15A1-F GGTGACACTGGTTTACCTGGCT COL15A1-R GCCTTTCCAGAGGAATGTCCTC HMGA2-F GAAGCCACTGGAGAAAAACGGC HMGA2-R GGCAGACTCTTGTGAGGATGTC PTX3-F CGAAATAGACAATGGACTCCATCC PTX3-R CTCATCTGCGAGTTCTCCAGCA SERPINB4-F CATGTTGATAGGTCAGGAAATG SERPINB4-R ATTGATACGTCTTTTCTCCG siRNAs: control Negative allstars cat #1027281 Qiagen PARN #1 GAAAAGAAGGAGCGAUAUA Dharmacon PARN #2 CAUGAGAGGGCUUGCCGUA Dharmacon PAN2 #1 GACCUUGUUUGCUGGAUUA Dharmacon PAN2 #2 UCAAGGGUCUUUAUGAGAA Dharmacon PAN3 #1 AAAACAAGGUUGCGAGUAA Dharmacon PAN3 #2 CGACUUACUUCUAUACAGA Dharmacon CNOT1 #1 CUAUAAAGAGGGAACGAGA Dharmacon CNOT1 #2 GGCCAAAUUGUCUCGAAUA Dharmacon CNOT2 #1 CAUGAAUGGAGGAGACGUA Dharmacon CNOT2 #2 GGCAAGUUUAUACGGGCAA Dharmacon CNOT3 #1 GCACUAAGGCACAGUAUCU Dharmacon CNOT3 #2 AGACAUGGGUAGCGUCCAA Dharmacon CNOT6 #1 GAAAGAACGUGGCUAUAAU Dharmacon CNOT6 #2 GAGCACAGGUGGAGUAGAA Dharmacon CNOT6L #1 UGACAGCGCUGCACCUAAA Dharmacon CNOT6L #2 CCAAUUACACCUUUGAUUU Dharmacon CNOT7 #1 CAGCUAGGACUGACAUUUA Dharmacon CNOT7 #2 GGAGAAUUCAGGAGCAAUG Dharmacon CNOT8 #1 UUUCGUAGUUCCAUAGAUU Dharmacon CNOT8 #2 GAGAAUAGCCAGGUUAUCU Dharmacon DCP1A #1 Hs_DCP1A_6 Qiagen DCP1A #2 Hs_DCP1A_7 Qiagen DCP2 #1 GCUUGAAGGCACAACGUAA Dharmacon DCP2 #2 GUAUGGAGGUCUUGAGAAU Dharmacon EDC3 #1 CCUGAUAACAAACGCCUUA Dharmacon EDC3 #2 GGAGAUUGAUACCUAUGAA Dharmacon EDC4 #1 GGAUGGAGAUCGGCAUAAU Dharmacon EDC4 #2 GGACCAUGCCACCCAUUAA Dharmacon DDX6 #1 AGUAUGACCACCACUAUUA Dharmacon DDX6 #2 GAAGGACAAUAUACAAGCA Dharmacon 2023 The Authors EMBO reports 24: e56327 | 2023 15 of 20 D ow nloaded from https://w w w .em bopress.org on January 18, 2024 from IP 2405:201:500a:6157:1950:e193:51b3:796d. .. Reagents and Tools table (continued) Reagent/Resource Reference or source Identifier or catalog number LSM1 #1 CGAGATGGAAGGACACTTATA Qiagen LSM1 #2 CAGCCTCATCGAGGACATTGA Qiagen XRN1 #1 AGAUGAACUUACCGUAGAAUU Burgess & Mohr (2015) XRN1 #2 CAGGTCGTAAATATCAAATAA Qiagen/Burgess & Mohr, (2015) EXOSC9 #1 GCCAAGAAUGCUCCCAUAAU van Dijk et al (2007) EXOSC9 #2 GCAGAAAUUACAGAGCUAA[dT][dT] Sigma TTC37 #1 CAGUGAGACUCGACAGUAA Dharmacon TTC37 #2 GUGUUAUGGUCGUGCAUUA Dharmacon WDR61 #1 AGGAACUCAUGUCGGGAAA Dharmacon WDR61 #2 CAAAGAGAAUGUACGGAUU Dharmacon SKIV2L2 #1 GCACAUACCUCAGCGGGAA Dharmacon SKIV2L2 #2 AGGGAAAAGCAGCGUGUAA Dharmacon XRN2 #1 AAGAGUACAGAUGAUCAUGUU West et al (2004) XRN2 #2 ACACUGUAGUCAGUAUUAAUU Wagschal et al (2012) TNKS1BP1 #1 GAUUCACUGGGUACCUACA[dT][dT] Sigma TNKS1BP1 #2 CACUUUGUGCCUCCUGGGA[dT][dT] Sigma ANXA1 GUGUUCAAUACCAUCCUUA[dT][dT] Sigma LRRC15 CUGACUACCAUUCAGGUCA[dT][dT] Sigma SPARC CUACAUCGGGCCUUGCAAA[dT][dT] Sigma Chemicals, enzymes and other reagents Human IL-4 R&D Systems 6507-IL-010/CF Human IL-12 R&D Systems 10018-IL-010 Human IFN-beta R&D Systems 8499-IF-010/CF actinomycin D Fisher AAJ60148LB0 qScript XLT Quanta 95132-500 SsoAdvanced SYBR green supermix Bio-Rad 1725274 Software SAMtools Li et al (2009) BEDtools Quinlan (2014) BBMAP https://sourceforge.net/projects/bbmap/ TrimGalore https://www.bioinformatics.babraham.ac.uk/projects/trim_galore/ Guppy v4.2.2 MiniMap2 Li (2018) Nanopolish v0.13.3 https://github.com/jts/nanopolish Other NextSeq 550 Illumina CellInsight CX7 LZR Thermofisher DynabeadsTM mRNA Purification Kit Fisher 61006 NEBNext® UltraTM II RNA Library Prep Kit for Illumina NEB E7300S MinION MkIb Oxford Nanopore Technologies Ltd 16 of 20 EMBO reports 24: e56327 | 2023 2023 The Authors D ow nloaded from https://w w w .em bopress.org on January 18, 2024 from IP 2405:201:500a:6157:1950:e193:51b3:796d. .. Cell infection and virus production Normal human dermal fibroblasts (NHDFs) were obtained from Lonza, grown in DMEM supplemented with 5% FBS in the presence of penicillin and streptomycin, and routinely screened for mycoplasma contamination.

    Article Title: Analysis of the effect of baseline detection and early clearance of ct-DNA, on survival outcomes among patients with advanced EGFR-mutant non-small cell lung cancer.
    Article Snippet: .. The digital PCR data was analyzed using the Quanta Soft analytical software package version 1.3.2.0 (BioRad, USA). ..

    Article Title: Utilizing Feline Lentiviral Infection to Establish a Translational Model for COVID-19 in People with Human Immunodeficiency Virus Infection
    Article Snippet: Amplified samples were read in the FAM and HEX channels of a QX200 reader (Bio-Rad). .. Data were analyzed and expressed as Log10 (copies/mL) with Quanta soft Software 1.7 (Bio-Rad) [ ]. ..

    Article Title: miR-146a-5p mediates inflammation-induced β cell mitochondrial dysfunction and apoptosis
    Article Snippet: PCR was performed using a C1000 Thermal Cycler (Bio-Rad), and droplets were read using a QX200 droplet reader (Bio-Rad). .. Data was analyzed within Quanta SoftTM Software (Bio-Rad). ..

    Article Title: Pks ‐positive Escherichia coli in tumor tissue and surrounding normal mucosal tissue of colorectal cancer patients
    Article Snippet: .. The 96‐well plate was transferred to the QX200 droplet reader (Bio‐Rad Laboratories), and data were analyzed with Quanta Software version 1.7.4 (Bio‐Rad Laboratories). ..

    Article Title: Clinical impact of mixed pulmonary carcinoma and carcinoid: the driver from their mono-clonal origin.
    Article Snippet: After cycling, the 96-well plate was placed into the QX200 Droplet Reader (Bio-Rad), where droplets of each sample are analyzed sequentially and fluorescent signals of each droplet are measured individually by a detector. .. Data were analyzed with the Quanta Soft analysis software, version 1.7.4 (Bio-Rad). ..

    Article Title: miR-146a-5p mediates inflammation-induced β cell mitochondrial dysfunction and apoptosis.
    Article Snippet: PCR was performed using a C1000 Thermal Cycler (Bio-Rad), and droplets were read using a QX200 droplet reader (Bio-Rad). .. Data was analyzed within Quanta SoftTM Software (Bio-Rad). .. Data are presented as the number of copies/μL. qRT-PCR for miRNA and mRNA miScript or miRCURY LNA Primer Assay was used to quantify the expression of miR-146a-5p (MS00003535 or YP00204688; Qiagen) in MIN6 cells or mouse pancreatic islets.

    Article Title: Pilot Study by Liquid Biopsy in Gastrointestinal Stromal Tumors: Analysis of PDGFRA D842V Mutation and Hypermethylation of SEPT9 Presence by Digital Droplet PCR
    Article Snippet: After thermal cycling, the fluorescent signals of droplets were detected in the FAM and HEX channels of a QX200 droplet reader (Bio-Rad Laboratories, Hercules, CA, USA). .. The ddPCR data were analyzed using Quanta Soft v.1.7 Software (Bio-Rad Laboratories, Hercules, CA, USA). ..

    Purification:

    Article Title: CCR4-NOT differentially controls host versus virus poly(a)-tail length and regulates HCMV infection.
    Article Snippet: Reagents and Tools table (continued) Reagent/Resource Reference or source Identifier or catalog number GDF15-R ACTTCTGGCGTGAGTATC NOV-F GGAACCGTCAATGTGAGATGCTG NOV-F GGCTTTGAGTGACTTCTTGGTGC TNFRSF11-F GGTCTCCTGCTAACTCAGAAAGG TNFRSF11-R CAGCAAACCTGAAGAATGCCTCC COL15A1-F GGTGACACTGGTTTACCTGGCT COL15A1-R GCCTTTCCAGAGGAATGTCCTC HMGA2-F GAAGCCACTGGAGAAAAACGGC HMGA2-R GGCAGACTCTTGTGAGGATGTC PTX3-F CGAAATAGACAATGGACTCCATCC PTX3-R CTCATCTGCGAGTTCTCCAGCA SERPINB4-F CATGTTGATAGGTCAGGAAATG SERPINB4-R ATTGATACGTCTTTTCTCCG siRNAs: control Negative allstars cat #1027281 Qiagen PARN #1 GAAAAGAAGGAGCGAUAUA Dharmacon PARN #2 CAUGAGAGGGCUUGCCGUA Dharmacon PAN2 #1 GACCUUGUUUGCUGGAUUA Dharmacon PAN2 #2 UCAAGGGUCUUUAUGAGAA Dharmacon PAN3 #1 AAAACAAGGUUGCGAGUAA Dharmacon PAN3 #2 CGACUUACUUCUAUACAGA Dharmacon CNOT1 #1 CUAUAAAGAGGGAACGAGA Dharmacon CNOT1 #2 GGCCAAAUUGUCUCGAAUA Dharmacon CNOT2 #1 CAUGAAUGGAGGAGACGUA Dharmacon CNOT2 #2 GGCAAGUUUAUACGGGCAA Dharmacon CNOT3 #1 GCACUAAGGCACAGUAUCU Dharmacon CNOT3 #2 AGACAUGGGUAGCGUCCAA Dharmacon CNOT6 #1 GAAAGAACGUGGCUAUAAU Dharmacon CNOT6 #2 GAGCACAGGUGGAGUAGAA Dharmacon CNOT6L #1 UGACAGCGCUGCACCUAAA Dharmacon CNOT6L #2 CCAAUUACACCUUUGAUUU Dharmacon CNOT7 #1 CAGCUAGGACUGACAUUUA Dharmacon CNOT7 #2 GGAGAAUUCAGGAGCAAUG Dharmacon CNOT8 #1 UUUCGUAGUUCCAUAGAUU Dharmacon CNOT8 #2 GAGAAUAGCCAGGUUAUCU Dharmacon DCP1A #1 Hs_DCP1A_6 Qiagen DCP1A #2 Hs_DCP1A_7 Qiagen DCP2 #1 GCUUGAAGGCACAACGUAA Dharmacon DCP2 #2 GUAUGGAGGUCUUGAGAAU Dharmacon EDC3 #1 CCUGAUAACAAACGCCUUA Dharmacon EDC3 #2 GGAGAUUGAUACCUAUGAA Dharmacon EDC4 #1 GGAUGGAGAUCGGCAUAAU Dharmacon EDC4 #2 GGACCAUGCCACCCAUUAA Dharmacon DDX6 #1 AGUAUGACCACCACUAUUA Dharmacon DDX6 #2 GAAGGACAAUAUACAAGCA Dharmacon 2023 The Authors EMBO reports 24: e56327 | 2023 15 of 20 D ow nloaded from https://w w w .em bopress.org on January 18, 2024 from IP 2405:201:500a:6157:1950:e193:51b3:796d. .. Reagents and Tools table (continued) Reagent/Resource Reference or source Identifier or catalog number LSM1 #1 CGAGATGGAAGGACACTTATA Qiagen LSM1 #2 CAGCCTCATCGAGGACATTGA Qiagen XRN1 #1 AGAUGAACUUACCGUAGAAUU Burgess & Mohr (2015) XRN1 #2 CAGGTCGTAAATATCAAATAA Qiagen/Burgess & Mohr, (2015) EXOSC9 #1 GCCAAGAAUGCUCCCAUAAU van Dijk et al (2007) EXOSC9 #2 GCAGAAAUUACAGAGCUAA[dT][dT] Sigma TTC37 #1 CAGUGAGACUCGACAGUAA Dharmacon TTC37 #2 GUGUUAUGGUCGUGCAUUA Dharmacon WDR61 #1 AGGAACUCAUGUCGGGAAA Dharmacon WDR61 #2 CAAAGAGAAUGUACGGAUU Dharmacon SKIV2L2 #1 GCACAUACCUCAGCGGGAA Dharmacon SKIV2L2 #2 AGGGAAAAGCAGCGUGUAA Dharmacon XRN2 #1 AAGAGUACAGAUGAUCAUGUU West et al (2004) XRN2 #2 ACACUGUAGUCAGUAUUAAUU Wagschal et al (2012) TNKS1BP1 #1 GAUUCACUGGGUACCUACA[dT][dT] Sigma TNKS1BP1 #2 CACUUUGUGCCUCCUGGGA[dT][dT] Sigma ANXA1 GUGUUCAAUACCAUCCUUA[dT][dT] Sigma LRRC15 CUGACUACCAUUCAGGUCA[dT][dT] Sigma SPARC CUACAUCGGGCCUUGCAAA[dT][dT] Sigma Chemicals, enzymes and other reagents Human IL-4 R&D Systems 6507-IL-010/CF Human IL-12 R&D Systems 10018-IL-010 Human IFN-beta R&D Systems 8499-IF-010/CF actinomycin D Fisher AAJ60148LB0 qScript XLT Quanta 95132-500 SsoAdvanced SYBR green supermix Bio-Rad 1725274 Software SAMtools Li et al (2009) BEDtools Quinlan (2014) BBMAP https://sourceforge.net/projects/bbmap/ TrimGalore https://www.bioinformatics.babraham.ac.uk/projects/trim_galore/ Guppy v4.2.2 MiniMap2 Li (2018) Nanopolish v0.13.3 https://github.com/jts/nanopolish Other NextSeq 550 Illumina CellInsight CX7 LZR Thermofisher DynabeadsTM mRNA Purification Kit Fisher 61006 NEBNext® UltraTM II RNA Library Prep Kit for Illumina NEB E7300S MinION MkIb Oxford Nanopore Technologies Ltd 16 of 20 EMBO reports 24: e56327 | 2023 2023 The Authors D ow nloaded from https://w w w .em bopress.org on January 18, 2024 from IP 2405:201:500a:6157:1950:e193:51b3:796d. .. Cell infection and virus production Normal human dermal fibroblasts (NHDFs) were obtained from Lonza, grown in DMEM supplemented with 5% FBS in the presence of penicillin and streptomycin, and routinely screened for mycoplasma contamination.

    Digital PCR:

    Article Title: Analysis of the effect of baseline detection and early clearance of ct-DNA, on survival outcomes among patients with advanced EGFR-mutant non-small cell lung cancer.
    Article Snippet: .. The digital PCR data was analyzed using the Quanta Soft analytical software package version 1.3.2.0 (BioRad, USA). ..



    Similar Products

    86
    Accelrys program suite quanta 2000
    Program Suite Quanta 2000, supplied by Accelrys, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/program+quanta/program+quanta/pm22582136__ml2002532_si_001-23-1-5
    Average 86 stars, based on 1 article reviews
    program suite quanta 2000 - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    90
    wavemetrics inc quanta analysis 8.20 program
    Quanta Analysis 8.20 Program, supplied by wavemetrics inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/program+quanta/quanta+analysis+8+20+program/pm34510285-82-7-16
    Average 90 stars, based on 1 article reviews
    quanta analysis 8.20 program - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Polygen GmbH quanta program
    Quanta Program, supplied by Polygen GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/program+quanta/quanta+program/us09969776-374-14-16
    Average 90 stars, based on 1 article reviews
    quanta program - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    96
    Bio-Rad quanta software program version 1 4 0
    Quanta Software Program Version 1 4 0, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/program+quanta/ChromLab+Software/pm28139399-63-10-15
    Average 96 stars, based on 1 article reviews
    quanta software program version 1 4 0 - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    90
    Accelrys quanta program
    Quanta Program, supplied by Accelrys, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/program+quanta/program+quanta/us09708403-1064-15-19
    Average 90 stars, based on 1 article reviews
    quanta program - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Accelrys computer program quanta 2005
    Computer Program Quanta 2005, supplied by Accelrys, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/program+quanta/computer+program+quanta+2005/us09695226-254-10-15
    Average 90 stars, based on 1 article reviews
    computer program quanta 2005 - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Accelrys program quanta
    Program Quanta, supplied by Accelrys, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/program+quanta/program+quanta/pm26151189-108-6-8
    Average 90 stars, based on 1 article reviews
    program quanta - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    Image Search Results